Biology, 19.11.2019 17:31 katie713518
The meselson-stahl experiment provided the necessary evidence to discover the mechanism by which dna replicates. they accomplished this discovery by first culturing dna with the heavy 15n nitrogen isotope. they then allowed the "heavy" dna to replicate with dna grown in normal 14n nitrogen. the density of each generation of replicated dna was recorded by marking its position in a test tube after centrifugation. the position of each generation was then compared to the positions of pure 15n dna and pure 14n dna. suppose that the first generation after replication revealed two bands after being centrifuged: one at the pure 14n mark, and one at the pure 15n mark. which method of replication would this observation support? (2 points) a. dispersive replication b. conservative replication c. semiconservative replication d. another generation would be needed in order to find a viable mechanism
Answers: 1
Biology, 21.06.2019 23:00
Approximately 90% of all cases of polycystic kidney disease are inherited in an autosomal dominant fashion. the disease is typically related to mutations to genes (pkd1 and pkd2). pkd genes can be found on chromosome 16. the disease occurs in approximately 1: 800 to 1: 1000 people. here is a hypothetical example. the dominant allele d will cause the development of pkd. the recessive allele is known as d. what genotypes would correspond to suffering from pkd? dd, dd what genotypes would correspond to being normal (not suffering from pkd)? dd consider that 1: 1,000 people have pkd in your population of 325million. consider that pkd is inherited in an autosomal dominant fashion. show you math for all of the following questions: what is the genotypic frequency for dd? what is the genotypic frequency for dd? what is the genotypic frequency for dd? what is p? what is q? how many people in your population would have pkd?
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:30
Which anatomical plane is the only one that could not show both the sternal region and vertebral region
Answers: 1
Biology, 22.06.2019 15:30
What property of water provides for appropriate sugar, salt, and amino acid levels to be present and carried in the blood of animals to be delivered to cells
Answers: 1
The meselson-stahl experiment provided the necessary evidence to discover the mechanism by which dna...
Mathematics, 21.03.2020 00:25
History, 21.03.2020 00:25
English, 21.03.2020 00:25
History, 21.03.2020 00:25
English, 21.03.2020 00:25
Mathematics, 21.03.2020 00:25
Business, 21.03.2020 00:25
Mathematics, 21.03.2020 00:25
Mathematics, 21.03.2020 00:25
Spanish, 21.03.2020 00:25