The insulin used to treat people with diabetes is commonly produced by intserting the dna sequence for human insulin into a bacterium. the insulin the bacterium produces using that sequence is then harvest. in fact dna sequence from virtually any living organisms could be inserted into a bacterium and the bacterium would be able to use the sequence to make the same proteins that the original organism did. in what way does this provide evidence for evolution

Describe how a student should adjust the microscope to see the cells on a slide more clearly?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Agroup of organisms that changes over time is said to