subject
Biology, 24.06.2019 20:00 mdaniella522

Adna strand with the sequence a-t-t-g-c-t would be complementary to which of the following? *

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 04:00
Why are fossils not found in igneous rocks? igneous rocks are made from cooling of lava or magma. igneous rocks are found too deep underground. igneous rocks are too dark in color to contain fossils. igneous rocks are too dense to contain fossils.
Answers: 2
question
Biology, 22.06.2019 08:40
What best explains whether bromine (br) or neon (ne) is more likely to form a covalent bond? bromine forms covalent bonds because it has seven valence electrons, but neon has eight valence electrons and already fulfills the octet rule. bromine forms covalent bonds because it has many electron shells, but neon has only two electron shells and is tightly bound to its electrons. neon forms covalent bonds because it can share its valence electrons, but bromine has seven valence electrons and can gain only one more electron. neon forms covalent bonds because it has only two electron shells, but bromine has many electron shells and will lose electrons in order to fulfill the octet rule.
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 13:50
The serengeti plains are part of the african savanna ecosystem and are home to a variety of different species of plants and animals. the serengeti plains experience a seven-month period of seasonal drought each year, during which the ecosystem receives only four inches of rain and the availability of some resources becomes very scarce. which type of limiting factors does the seasonal drought in the serengeti plains affect?
Answers: 2
You know the right answer?
Adna strand with the sequence a-t-t-g-c-t would be complementary to which of the following? *...
Questions
Questions on the website: 13722367