Answers: 1
Biology, 22.06.2019 03:00
During the day, plants produce by splitting water molecules in the light-dependent reactions of photosynthesis. at the same time, plants use cellular respiration to produce some of the needed by the light-independent reactions to make sugars. during the night, plants produce because takes place.
Answers: 3
Biology, 22.06.2019 10:40
Which of the following factors would not contribute to allopatric speciation? a) a population becomes geographically isolated from the parent population.b) the separated population is small, and genetic drift occurs.c) the isolated population is exposed to different selection pressures than the ancestral population.d) different mutations begin to distinguish the gene pools of the separated populations.e) gene flow between the two populations is extensive.
Answers: 2
Biology, 22.06.2019 10:50
The small molecule cyclic amp (camp) takes about 0.2 second to diffuse 10 μm, on average, in a cell. suppose that camp is produced near the plasma membrane on one end of the cell; how long will it take for this camp to diffuse through the cytosol and reach the opposite end of a very large cell, on average? assume that the cell is 200 μm in diameter.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
What is the main component of atoms that determain the type of bond that forms between atoms or comp...
Chemistry, 15.10.2019 11:50
History, 15.10.2019 11:50
Mathematics, 15.10.2019 11:50
History, 15.10.2019 11:50
Physics, 15.10.2019 11:50
Biology, 15.10.2019 11:50
Mathematics, 15.10.2019 11:50
English, 15.10.2019 11:50
Mathematics, 15.10.2019 11:50
Mathematics, 15.10.2019 11:50
Health, 15.10.2019 11:50