subject
Biology, 29.06.2019 05:30 naiquawhite

Which of the following terms describes a set of chemical reactions used by the cell to build up and break down molecules necessary for the function of the cell? respiration organism metabolism chemosynthesis

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 03:00
The unique structure of the neuron is dedicated to the efficient and rapid transmission of neural signals. the relationship between neurons, the spinal cord, and the brain constitutes an elaborate communication system throughout the human body. all but one of the functions listed below are a result of this interaction.
Answers: 1
question
Biology, 22.06.2019 04:00
What amino acid is coded for by this sequence after the mutation
Answers: 1
question
Biology, 22.06.2019 08:30
Scientists discover two populations of mice on either side of a major river. the two populations have almost identical genes but the mice from one side cannot breed with mice from the other. this is most likely because
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Which of the following terms describes a set of chemical reactions used by the cell to build up and...
Questions
question
Mathematics, 17.02.2021 01:30
question
Chemistry, 17.02.2021 01:30
question
History, 17.02.2021 01:30
question
Mathematics, 17.02.2021 01:30
question
World Languages, 17.02.2021 01:30
question
Social Studies, 17.02.2021 01:30
Questions on the website: 13722367