5' atgcccgggtgtcgtagttga3' complete the complementary sequence for the template strand

Why does it matter if osmosis is put into a “scab” or a “nosebleed? ” where would that leave him?

Residential construction is expanding in florida, the expansion has caused fragmentation of habitats, one of the results of the increased construction is a decrease in the number of large predators such as the coyote, black bear and pool panther, which will be the most immediate local result of this fragmentation? 1)large predators will become extinct 2)decrease in middle sized predators 3)increase in population of top carnivores 4)increase in population of prey species

Across of blue x blue (both heterozygous) would result in