Biology, 04.07.2019 12:30 karose4590

5’atgcccgggtgtcgtagttga3’ complete the complementary sequence for theme template strand above. what would the mrna be based upon the template strand above? mrna what would the primary linear structure of the protein be based upon the mrna strand above?due tonight.

Answers: 1

Show answers

Another question on Biology

Biology, 21.06.2019 17:30

In order to clone adult animals, scientists typically begin with a(n)

Answers: 1

Answer

Biology, 22.06.2019 03:30

Acommon kind of mechanical weathering is called

Answers: 1

Answer

Biology, 22.06.2019 21:00

Carbon compound that stores and transmits genetic information is called

Answers: 1

Answer

Biology, 22.06.2019 22:20

List do people affect the environment

Answers: 1

Answer

You know the right answer?

5’atgcccgggtgtcgtagttga3’ complete the complementary sequence for theme template strand above. what...

Questions

History, 10.02.2021 20:30

How far do you agree with the statement that the civil war was caused by the issue of slavery (18 marks)...

Mathematics, 10.02.2021 20:30

solving linear inequality PLEASE HELP !! eqaution: x < 4 answer choices: 3 , 1 , 6 , 9...

Mathematics, 10.02.2021 20:30

Is this relation below a function? Use the graph below to justify your response. (0,0), (2,0), (2,2), and (3,4)

Mathematics, 10.02.2021 20:30

R'(2,-9) is the image of R after a reflection in the line y = x. What are the coordinates of R?...

Social Studies, 10.02.2021 20:30

What is your thought on the Indian act?...

Mathematics, 10.02.2021 20:30

The Smiths spend 9% of their budget on entertainment. Their total budget this year is $2,000 more than last year, and this year they plan to spend $4...

Mathematics, 10.02.2021 20:30

whoever is deleting my stuff please stop and own up to it and tell me please i will give points to whoever is doing it DON'T ANSWER THIS UNLESS YOU AR...

Spanish, 10.02.2021 20:30

Can anybody help me with my assghnment it's Spanish so plss. Question 1 (1 point) Match the verb with the word that best complete each phrase...

Mathematics, 10.02.2021 20:30

What is the complex conjugate of –6 +41? -6-41 -6i +4 6 – 41 6i - 4...

Social Studies, 10.02.2021 20:30

How many soldiers did it take to operate the Napoleon Cannon?...

Mathematics, 10.02.2021 20:30

A radio station had 204 tickets to a concert. They gave away 5 times as many tickets to listeners as to employees. How many tickets did they give away...

Biology, 10.02.2021 20:30

3. The diagram below represents a cell observed under medium power. If the field diameter is 1600 pm, determine the size of this cell in pm. [1 mark]...

Mathematics, 10.02.2021 20:30

Please helpp...I only need help on the bottom chart

Mathematics, 10.02.2021 20:30

Find the value of h in the parallelogram. Type only the number value of your answer. Round to the nearest tenth. h =

Mathematics, 10.02.2021 20:30

I have a math test today and this is the only question I didn’t really understand-

Mathematics, 10.02.2021 20:30

Each car can hold 5 students and each minibus can hold 15 students. There will be 85 students on the trip. Let x be the number of cars and y th...

Biology, 10.02.2021 20:30

2.Andrea divided a group of a species of insect she found in her backyard into two groups based on antenna size. The insects with short antennae produ...

Physics, 10.02.2021 20:30

A skateboard has a momentum of 25 kg(m/s)what will be the momentum If its mass is double ?...

Biology, 10.02.2021 20:30

What is extinction? Your own word...

Biology, 10.02.2021 20:30

1.What is the main factor causing the salinity of the Everglades to change?(1 point) snake populations flood control levees c...

More questions: Biology Another questions