Biology, 12.07.2019 09:30 potternatalie90

Neurotransmitters are that travel across the to another cell.

Answers: 1

Show answers

Another question on Biology

Biology, 21.06.2019 22:00

Protein synthesis actually begins in the nucleus when transcribes a single gene on the dna molecule is copied. the process of copying this gene is called this copy is known as and contains the protein building instructions. this copy is sent out into the cytoplasm to the part of the cell known as the the of the ribosome will join together to form a functional ribosome when they attach to the mrna. as the mrna moves through the ribosome, the message is read by transfer rna brings the correct back to the ribosome. the amino acids are placed in the correct order and are hitched together by

Answers: 3

Answer

Biology, 22.06.2019 05:20

When plants use sunlight to make food, the energy of sunlight is

Answers: 1

Answer

Biology, 22.06.2019 06:00

Im inn a ! what"s the answer which of the following is one way creativity can scientists? by ensuring they follow the scientific method by increasing the amount of time it takes to complete scientific experiments by making sure they only try things that have already been proven by leading them to ask more questions about the natural world

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

Neurotransmitters are that travel across the to another cell....

Questions