Biology, 19.07.2019 20:00 bvghchg2580
Look at the photo of the leaf. which term describes this leaf's vein arrangement?
Answers: 2
Biology, 22.06.2019 09:00
When the cell concentrates potassium within, against the natural tendency of matter, it is performing a.passive diffusion b.facilitated diffusion c.active transport d.pinocytosis
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 16:10
The lake of the ozarks is a human-made lake, so it collects runoff from coal strip-mining, fertilizers, resort wastewaters, and septic drainages. the average lake temperature is between 10∘c and 21∘c. consider the physical requirements for growth and multiplication that would allow fecal coliforms to “blossom” in the lake of the ozarks. which of the following would accurately describe these organisms? check all that apply. psychrophiles facultative halophiles extremophiles mesophiles hyperthermophiles
Answers: 2
Biology, 22.06.2019 17:30
The diagram shows the results when two parents are crossed. the letters represent alleles for a trait that is controlled by three different genes. which best describes this inheritance pattern? multiple allele because a trait is controlled by three different genes polygenic because the offspring have alleles from both parents multiple allele because the offspring have alleles from both parents polygenic because a trait is controlled by three different genes
Answers: 1
Look at the photo of the leaf. which term describes this leaf's vein arrangement?...
Mathematics, 09.07.2019 19:30
Physics, 09.07.2019 19:30
Health, 09.07.2019 19:30
Mathematics, 09.07.2019 19:30
Mathematics, 09.07.2019 19:30
World Languages, 09.07.2019 19:30
Geography, 09.07.2019 19:30
Mathematics, 09.07.2019 19:30
World Languages, 09.07.2019 19:30
Mathematics, 09.07.2019 19:30