Normal hemoglobin dna - cacgtggactgaggactcctc what is the normal hemoglodin acid- normal hemoglobin a. a sequnce for figuring out rna a binds with u c binds with g

Populations of blue-winged warblers, a type of bird, migrate south in the winter and return to canadian breeding grounds in the spring. as global temperatures have increased due to climate change, spring has started arriving in the warbler's breeding grounds earlier in the year, before the warblers return. warblers now arrive at their breeding grounds too late to select ideal nesting sites and to feed on important early-spring food sources how are populations of blue-winged warblers most likely to be affected by the earlier arrival of spring? o a. populations will go extinct since the warblers will stop migrating to breeding grounds. b. populations will be unaffected since most species can quickly adapt to effects of climate change. c. populations will increase since warmer temperatures are generally beneficial to survival, d. populations will decline since individuals will be less likely to successfully reproduce, reset next

Which of the following statements about archaea and bacteria is true? a. neither is single-celled. b. they both have nuclear membranes. c. neither reproduces by binary fission. d. they both lack a nuclear membrane.

Isolated volcanic peaks on the ocean floor are